Perl assignment
Question Description
1.Create a Perl Script that will translate the following DNA sequence (ATGCTGACCATTTTCTTTTCCTCCACTGAAGCA)
into the 6 possible amino acid sequences (that means the 3 frame shift sequences of the original and the 3-frame shift sequences of the reverse complement). Submit your code as well as the amino acid sequences.
2. Use a Perl Script to compare the query sequence to each of the subject sequences in this alignment below to identify which subject sequence has the highest sum of BLOSUM62 comparison score? ( another question (exactly like this one.))
Have a similar assignment? "Place an order for your assignment and have exceptional work written by our team of experts, guaranteeing you A results."
